Abstract
Antibiotics are drugs used to fight infections caused by bacteria. They are one of the most important discoveries in medicine that has saved and continues to save millions of lives each year, but their effectiveness is threatened because bacteria can adapt and resist treatment. The present study aimed to identify the bla NDM, bla SHV and bla TOHO genes in Escherichia coli strains isolated from patients at the Pietro Annigoni Biomolecular Research Center (CERBA) in Ouagadougou. The isolation and purification of bacterial strains from the stools and urine of internal and external patients of CERBA were carried out on selective media and Muller Hinton (MH) medium. The antibiogram was carried out according to the disc diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the bla NDM, bla SHV and bla TOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were isolated, including 85 (69.67%) strains of E. coli. All E. coli strains were resistant to at least one of the antibiotics studied. Conventional PCR showed that 48.23% (41/85) of E. coli strains carried at least one gene studied. Among the 85 E. coli strains, 35.30% (30/85) of the strains harbored the bla NDM gene, 18.82% (16/85) bla SHV and 8.23% (7/85) of strains carrying the bla TOHO gene. Among the 85 strains, the coexistence of bla SHV genes + blah NDM, blah SHV + blah TOHO, blah TOHO + bla NDM, and bla SHV + bla NDM + bla TOHO were found in 16.47% (14/85) in total. This study has highlighted the multi-resistance of ESBL-producing E. coli strains carrying the bla NDM, bla SHV and bla TOHO genes. The strong coexistence of genes in certain E. coli strains requires efforts to find new therapeutic solutions to combat bacterial resistance.
Keywords
Resistance to Antibiotics, Enzymes, Enterobacteria, E.coli, SHV, NDM and TOHO Genes
1. Introduction
Resistant bacteria cause infections in humans or animals that are more difficult to treat than those caused by non-resistant bacteria. The choice of antibiotics that can be prescribed is indeed more limited. Bacteria can be resistant to one or more antibiotics; in which case we speak of multi-resistant bacteria (MDR). In extreme cases, fortunately still very rare, a bacterium can be resistant to all antibiotics that can be used in humans. It is then called pan-resistant and can lead to a therapeutic impasse with no further treatment possible. The most worrying MDRs are multi -resistant enterobacteria; enterobacteria such as Escherichia coli are bacteria in the digestive tract responsible for a very large number of infections.
Beta-lactam antibiotics remain the most widely used class of antibiotics worldwide. This is primarily due to the number of available products covering a relatively broad bacterial spectrum. the mechanism of defense the more widespread And THE more developed by bacteria against effects of These beta-lactams are produced by enzymes (beta-lactamases) that chemically modify the beta-lactams to make them inactive
.
Broad-spectrum β-lactamases (ESBL) are enzymes that confer resistance to oxyimino-cephalosporins and aztreonam
| [2] | Metuor Dabire, A., et al., Resistances to the Oxyimino-Cephalosporins by Ctx-M-15 Producing Klebsiella Isolated From the Urines Samples of Patients in the University Hospital Complex Pediatric Charles De Gaulle (CHUP-CDG) Of Ouagadougou in Burkina Faso Journal of Asian Scientific Research, 2013. 3(9): p. 882-890. http://aessweb.com/journal-detail.php?id=5003 |
[2]
. In fact, they result from mutations in the genes of common plasmid b-lactamases (notably SHV, TOHO and NDM) that alter the configuration of the enzyme at its active site to increase the affinity and hydrolytic capacity of the b-lactamase for oxyimino compounds. Organisms producing these ESBLs are clinically relevant and remain an important cause of treatment failure with oxyimino cephalosporins
| [3] | Tiemtoré, RYW, et al., Isolation and Identification of Escherichia coli and Klebsiella pneumoniae Strains Resistant to the Oxyimino-Cephalosporins and the Monobactam by Production of GES Type Extended Spectrum Beta-Lactamase (ESBL) at Saint Camille Hospital Center in Ouagadougou, Burkina Faso. Infect Drug Resist, 2022. 15: p. 3191-3204. https://doi.org/10.2147/IDR.S360945 |
[3]
. In effect THE researchers have found bacteria that can express up to eight β-lactamase genes at the same time (Bush, 2013). ESBLs are mainly produced by Enterobacteriaceae, particularly
Klebsiella pneumoniae (Ahmadi
et al., 2022)
and
Escherichia coli. | [4] | Ouedraogo AS, Jean Pierre H, Ban˜ uls AL, Oue´ draogo R, Godreuil S. Emergence and diffusion Antibiotic resistance in West Africa: contributing factors and threat assessment. Med Sante Trop 2017; 27: 147-154. https://doi.org/10.1684/mst.2017.0678 |
[4]
.
ESBL-carrying bacteria can also acquire and most often exhibit additional resistance to other classes of antibiotics such as monobactams (aztreonam), quinolones, tetracyclines, aminoglycosides (Tiemtoré and al., 2022). Our study focused on the NDM, SHV and TOHO genes present in E. coli. Our objective was to determine the presence of these resistance genes in E. coli isolated at the Pietro Annigoni Research Centre (CERBA).
2. Materials and Methods
2.1. Framework of the Study
The collection of our isolates was carried out at the Pietro Annigoni Biomolecular Research Center (CERBA) in Ouagadougou.
In-depth studies on the various isolates collected; such as identification, antibiotic sensitivity testing, and the search for ESBL genes using conventional PCR techniques were carried out at the Laboratory of Molecular Biology and Genetics (LABIOGENE). LABIOGENE is a research laboratory attached to the Doctoral School of Sciences and Technologies (ED/ST) of Joseph KI-ZERBO University. It has received the label of Center of Excellence from the West African Economic and Monetary Union (UEMOA).
2.2. Type of Study
This is a cross-sectional study of various ESBL-producing bacterial strains isolated at the Pietro Annigoni Biomolecular Research Center (CERBA) from March 1, 2024 to June 1, 2024.
2.3. Sampling
The samples selected were those received at the CERBA laboratory for bacteriological examinations and which, after analysis, allowed the detection of the presence of enterobacteria. Pus, urine, stool, vaginal and vulvar samples were included in our study.
The examination reports that were compliant included, among other things, the identity of the patient, the nature of the sample, the examination requested by the prescriber, the consultation and/or hospitalization service.
Samples collected in non-sterile equipment or suspected of any external soiling were excluded, as were samples collected the day before or days before for stool and urine samples.
2.4. Isolation and Identification of Gram-negative Bacilli
Bacterial isolation was performed using selective media. Urine and stool samples were inoculated onto standard media (URI select, CLED, BCP, Hektoen, SS) and incubated for 24 h at 37°C. Biochemical tests were performed on suspect colonies using Kligler Hajna, mannitol-mobility, Simmons citrate, urea-indole and peptone water media.
The API 20E biochemical gallery (BioMérieux, France) was then used for the identification of Enterobacteriaceae according to the manufacturer's recommendations. The selected colonies were purified by culture at 37°C for 24h on Muller-Hinton medium and used for antibiogram and DNA extraction.
2.5. Antibiotic Sensitivity Test
The Mueller-Hinton (MH) agar diffusion method was used for the antibiotic susceptibility test of strains according to the recommendations of the Antibiogram Committee of the French Society of Microbiology
| [5] | Eucast/Ca-Sfm (2021) Antibiogram Committee of the French Society of Microbiology. |
[5]
. The i noculum
Bacterial suspension was prepared by placing a pure colony in 5 ml of physiological saline. The suspension was then homogenized and calibrated to 0.5 McFarlane and then inoculated by tight streaks on the MH agar. The antibiotics were placed at a distance of approximately 20mm from each other, at a rate of 4 discs per Petri dish. The different diameters of the inhibition zones obtained around the antibiotic discs were measured after 24h of incubation at 37°C and compared to the CA-SFM standards to determine the sensitive (S), intermediate (I) and resistant (R) phenotypes. The antibiotics Ceftriaxone (CRO), Ceftazidime (CAZ), Cefotaxime (CTX), Imipenem (IMP), Amoxicillin + Clavulanic Acid (AMC) and Aztreonam (AT) were tested.
2.6. Extraction of Bacterial DNA
An isolated pure colony was picked from the MH Petri dishes and suspended in 200µl of sterile distilled water in Eppendorf tubes. The tubes were then soaked in a 100°C water bath for 15 minutes to release the genetic material from the bacteria. After centrifugation for 10 min at 12000 rpm, the supernatants containing the released DNA were transferred to new Eppendorf tubes. The quantity and purity of the DNA extracts were determined spectrophotometrically using the NanoDrop. The DNA was stored at -20°C until PCR analyses.
2.7. Gene Amplification
Bla TOHO, bla SHV, bla NDM genes were detected by conventional PCR using the specific primer pairs presented in (
Table 1). The PCR was carried out in a 20μL reaction mixture including 4μL of 5X Firepol
Master Mix; 0.5μL of sense and antisense primer, 14μL of PCR water and 1μL of DNA extract from each strain. Amplification was carried out using the GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, California, USA) according to an appropriate program (
Table 2).
Table 1. Primer sequence for bla SHV, bla TOHO genes and blah NDM.
Genoa | Primers | Sequences (5'- 3') | Sizes | References |
Bla SHV | Forward | ATG-CGT-TAT-ATT-CGC-CTG-TG | 875 bp | (Pagani et al., 2003) |
Reverse | TTA-GCG-TTG-CCA-GTG-CTC |
Bla TOHO | Forward | ATGTGCAGTACCAGTAA | 876 bp | (Laurent et al., 1999) |
Reverse | TAGGTCACCAGAACCAG |
Bla NDM | Forward | CCATGCGGGCCGTATGAGTGATT | 500 bp | (Mc Gann et al., 2012) |
Reverse | AAGCTGAGCACGCATTAGCCG |
Table 2. PCR program.
Genoa | Condition / duration |
Settings | Bla TOHO | Bla SHV | Bla NDM |
Initial denaturation | 96°C / 5 min | 96°C / 5 min | 96°C / 5 min |
Denaturation | 96°C / 1 min | 96°C / 1 min | 96°C / 30s |
Hybridization | 50°C / 1 min | 60°C / 1 min | 62°C / 30s |
Elongation | 72°C / 1 min | 72°C / 1 min | 72°C / 30s |
Final elongation | 72°C / 10 min | 72°C /10 min | 72°C /7 min |
Number of cycles | 35 | 35 | 30 |
2.8. Agarose Gel Electrophoresis
PCR-amplified DNA fragments were separated by electrophoresis on a 1% agarose gel prepared in a 1X tris base-borate-EDTA solution containing 0.5μg/mL ethidium bromide. Migration was performed at 110mV and 850mA for 30 minutes. A 100 bp molecular weight marker was used to determine the size of the amplicons visualized under UV light using the GeneFlash device (Syngene, Bio-Imaging, UK).
2.9. Statistical Analyses
The collected data were entered into Excel 2019 and then analyzed using the standard Statistical Package for Social Sciences (SPSS) version 22 software. The results were described in terms of percentage (%) and frequency for categorical variables.
3. Results
3.1. Bacterial Strains
We obtained a total of 122 strains of Gram-negative bacteria. Among these 122 strains, 69.67% (85/122) of E. coli strains were all resistant to at least one of the beta-lactams.
3.2. Distribution Strains of E. Coli in Function of the Samples Organic
Among the 85 strains of
E. coli we found 91.76% (78/85) in urine, 4.70% (04/85) in stool, 2.35% (02/85) in pus, and 1.17% (01/85) in a vaginal sample (VS). (
figure 1).
Figure 1. Distribution of strains bacterial in function of the samples organic.
3.3. Resistance of E. Coli Strains to Antibiotics
Figure 2. Resistance profile of Escherichia coli strains.
The antibiogram carried out on each strain of
E.coli allowed to study their resistance profiles with respect to the antibiotics tested. The results of the study on the resistance of the 85 isolates to the different antibiotics show that 85.88% were resistant to Amoxicillin + clavulanic acid, 71.76% were resistant to Ceftazidime, 76.47% were resistant to Ceftriaxone, 82.35% were resistant to Cefotaxime, 52.94% were resistant to Imipenem, 71.76% were resistant to Aztreonam (
figures 2 and 3).
Figure 3. Resistance phenotype E. coli on Petri dishes.
3.4. Molecular Characterization of Resistance Genes
Detection of resistant
E. coli strains by conventional PCR. Among them, 35.30% (30/85) of the strains harbored the bla NDM gene, 18.82% (16/85)
bla SHV and 8.23% (7/85) strains carried the
bla TOHO gene. Bla
NDM was the most detected gene in
E. coli (
figure 4).
Figure 4. Distribution of genes according to E.coli strains.
3.5. Distribution of Genes According to Biological Samples
Urine was the sample that contained much more beta-lactamase-producing
E.coli strains (
Table 3). In our study, we found in urine 35.90% (28/78) of strains carrying the NDM gene, 19.23% (15/78) of strains carrying the SHV gene, 8.97% (7/78) of strains carrying the TOHO gene. For stool, we found 25% (1/4) of strains carrying the NDM gene and also 25% (1/4) carrying the SHV gene. Regarding pus, we found 50% (1/2) of strains carrying NDM.
Table 3. Distribution of genes according to biological samples.
Genoa | Bla NDM | Bla SHV | Bla TOHO |
Samples | n (%) | n (%) | n (%) |
Urine | 28/78 (35.90) | 15/78 (19.23) | 7/78 (8.97) |
Saddles | 1/4 (25) | 1/4 (25) | 0 (0) |
Pus | 1/2 (50) | 0 (0) | 0 (0) |
Pv | 0 (0) | 0 (0) | 0 (0) |
3.6. Coexistence of Resistance Genes
PCR analysis also showed that among the 85
E. coli strains, the combinations of
bla SHV + genes
blah NDM, blah SHV +
blah TOHO, blah TOHO +
bla NDM and
bla SHV +
bla NDM+ bla TOHO were found in 16.47% (14/85) in total including 57.14% (8/14), 21.14% (3/14), 14.29% (2/14) and 7.14% (1/14) respectively.
Figure 5 shows the coexistence of resistance genes in
E.coli strains.
Figure 5. Coexistence of genes depending on E. coli strains.
3.7. Coexistence of the Genoa in Function of the Samples Organic
Strains carrying several genes were almost all found in urine, of which 21.42% (3/14) harbored both SHV and TOHO genes, 50% (7/14) SHV and NDM, 14.29% (2/14) TOHO and NDM, 7.14% (1/14) SHV, NDM and TOHO. In stools there were only 7.14% (1/14) strains that harbored both SHV and NDM (
Table 4).
Table 4. Coexistence of the Genoa in function of the samples organic.
Genoa | Bla SHV and bla TOHO | Bla SHV and bla NDM | Bla TOHO and bla NDM | Bla SHV, bla TOHO and bla NDM |
Samples | n (%) | n (%) | n (%) | n (%) |
Urine | 3/78 (3.84) | 7/78 (8.97) | 2/78 (2.56) | 1/78 (1.28) |
Saddles | 0 | 1/4 (25) | 0 | 0 |
Figure 6. Electrophoretic profiles of the different resistance genes present on E.coli samples.
The direction of migration is from top to bottom. M = 100 bp DNA Ladder; T-: Negative control. 1. Sample 5 is positive for the bla SHV gene. 2. Samples 2, 3, 5 and 6 are positive for the bla NDM gene. 3. Samples 13, 14, 16 and 18, 20 are positive for the bla TOHO gene.
4. Discussion
Bacteria that once caused mild infections have become multidrug-resistant and can now cause serious infections that complicate therapeutic strategies. The emergence of multidrug-resistant bacteria (MDB) is now a worrying global phenomenon
| [6] | Morrison, L. and TR Zembower, Antimicrobial Resistance. Gastrointest Endosc Clin N Am, 2020. 30(4): p. 619-635. |
[6]
. In our study, we found
bla NDM, bla SHV and
bla TOHO genes in many
Escherichia coli strains isolated from urine or stool cultures at CERBA, Ouagadougou, Burkina Faso. Most of the resistant
E. coli strains (91.76%) in the present study were isolated from urine, similar to previous studies by our research team in Burkina Faso
| [21] | Mètuor, DA, et al., Detection of multidrug-resistant enterobacteria simultaneously producing extended-spectrum -lactamases of the PER and GES types isolated at Saint Camille Hospital Center, Ouagadougou, Burkina Faso. African Journal of Microbiology Research, 2019. 13(26): p. 414-420. https://doi.org/10.5897/AJMR2019.9147 |
[21]
and Togo
| [7] | Diagbouga, S., et al., Detection of High Prevalence of TEM/SHV/CTX-M Genes in ESBL Producing and Multidrug Resistant Klebsiella pneumoniae and Klebsiella oxytoca. J Clin Diagn Res, 2016. 4(1): p. 000129. https://doi.org/10.4172/2376-0311.1000130 |
[7]
.
Escherichia coli strains represent the most important enterobacteria in bacterial infections, especially urinary tract infections
| [8] | Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, infection mechanisms, and treatment options. Nat Rev Microbiol. 2015; 13(5): 269. https://doi.org/10.1038/NRMICRO3432 |
[8]
. Indeed, it is estimated that 53.33% of women and 46.67% of men experience at least one episode of symptomatic urinary tract infection during their lifetime, and that 27 to 48% of affected women suffer from recurrent urinary tract infections.
E.coli strains (85.88%) were resistant to amoxicillin, a semi-synthetic penicillin, in combination with clavulanic acid which is a β-lactamase inhibitor
. Our results are higher than those of
| [10] | Arsalane, L., Kamouni, Y., Yahyaoui, H., Bennouar, N., Berraha, M., & Zouhair, S. (2014). Profile Current antibiotic resistance of uropathogenic Escherichia coli strains and therapeutic consequences. Progress in Urology, 24(16), 1058-1062. |
[10]
with a resistance rate to amoxicillin-clavulanate at 43% against a resistance rate of 13.7% in the city of El Jadida
| [11] | Nadmi H, Elotmani F, Talmi M, Zerouali K, Perrier-Gros-Claude JD, Timinouni M. Antibiotic resistance profile of community-acquired uropathogenic Enterobacteriaceae in El Jadida (Morocco). Med Mal Infect 2010; 40: 303-5. https://doi.org/10.1016/j.medmal.2009.08.020 |
[11]
. These high rates of resistance of
E. coli to amoxicillin justify that ami-nopenicillins are no longer currently recommended in the probabilistic treatment of urinary tract infections
| [10] | Arsalane, L., Kamouni, Y., Yahyaoui, H., Bennouar, N., Berraha, M., & Zouhair, S. (2014). Profile Current antibiotic resistance of uropathogenic Escherichia coli strains and therapeutic consequences. Progress in Urology, 24(16), 1058-1062. |
[10]
. Resistance rates to third-generation cephalosporins (C3G) of 71.76%, 76.47% and 82.35% were recorded respectively for Ceftazidime, Ceftriaxone, and Cefotaxime in the present study. Resistance to C3G has also been reported in previous studies in Burkina Faso. In the study by Zahir et
al, in Morocco, E
scherichia coli was resistant to amoxicillin in 80% of cases, to the amoxicillin-clavulanic acid combination in 59% of cases, and to third-generation cephalosporins. Drug pressure in hospitals, poor treatment control and the overuse of antibiotics, sometimes without medical prescription, are the main causes of the emergence and spread of multi-resistant pathogens. In addition, acquired resistance has a high power of dissemination due to its plasmid determinism. The resistance rate to Aztreonam (monobactams) was 71.76% compared to 52.94% for Imipenem in the present study. Contrary to the results of our study All isolated strains had high sensitivity to imipenem (100%), cefoxitin (81.25%) and sensitivities averages to ceftriaxone (53.12%) and cefotaxime (53.12%) in
| [12] | Linefiene, L., Tankoano, A., Fissou Yandai, H., Somda, NS, Oumar, O., & Traoré, Y. (2017). Prevalence and antibiotic susceptibility of diarrheal Escherichia coli strains in children under five years of age in Chad. Rev Microbiol Ind San Et Environn, 11(1), 16-30. |
[12]
. The results of the sensitivity of
E. coli to imipenem are comparable to those obtained by
| [13] | Yandaï FH., Zongo C., Moussa AM., Bessimbaye N., Tapsoba F., Savadogo A., Barro N., Ndoutamia, G. & Traoré AS. (2014). Prevalence and antimicrobial usceptibility of faecal carriage of Extended-Spectrum β-lactamase (ESBL) producing Escherichia coli at the “Mother and Child Hospital” in N’Djamena, Chad. Scientific Journal of Microbiology, 3, 25-31. https://doi.org/10.14196/sjm.v3i2.1152 |
[13]
in Chad which were (100%). This demonstrates the absence of carbapenemase-producing
E. coli strains | [12] | Linefiene, L., Tankoano, A., Fissou Yandai, H., Somda, NS, Oumar, O., & Traoré, Y. (2017). Prevalence and antibiotic susceptibility of diarrheal Escherichia coli strains in children under five years of age in Chad. Rev Microbiol Ind San Et Environn, 11(1), 16-30. |
[12]
. Resistance to aztreonam could be better explained by the presence of other resistance mechanisms, including AmpC β-lactamase or a combination of permeability defects and efflux mechanisms. Bacteria use various resistance mechanisms such as inactivation of antibiotics by enzymes.
Bla NDM gene
(35.30%) was the most common in the present study, followed by the
bla SHV gene
(18.82%) and the bla TOHO gene
(8.23%). New Delhi metallo-β-lactamase-1 (NDM-1) is an enzyme capable of hydrolyzing most β-lactam antibiotics. The prevalence of NDM-1-producing bacteria is receiving increasing attention as a global health threat given their spread in many environmental and animal reservoirs in Asia
| [14] | Bonardi, S. and R. Pitino, Carbapenemase-producing bacteria in food-producing animals, wildlife and environment: A challenge for human health. Ital J Food Saf, 2019. 8(2): p. 7956. https://doi.org/10.4081/ijfs.2019.7956 |
[14]
, the Middle East
| [15] | Bi, R., et al., High Prevalence of bla (NDM) Variants Among Carbapenem-Resistant Escherichia coli in Northern Jiangsu Province, China. Front Microbiol, 2018. 9: p. 2704. https://doi.org/10.3389/fmicb.2018.02704 |
[15]
, and India
| [16] | Bashir, T., & Ahmed, A. (2016). Colistin resistance among gram negative organisms; an evolving problem from tertiary care hospital, Pakistan 2014. American Journal of Microbiology. https://doi.org/0.3844/ajmsp.2016.29.31 |
[16]
. The
bla NDM1 gene is located on plasmids harboring multiple resistance determinants, thus conferring widespread drug resistance, leaving few or no therapeutic options
| [16] | Bashir, T., & Ahmed, A. (2016). Colistin resistance among gram negative organisms; an evolving problem from tertiary care hospital, Pakistan 2014. American Journal of Microbiology. https://doi.org/0.3844/ajmsp.2016.29.31 |
[16]
. NDM1 has been identified primarily in
Escherichia coli | [16] | Bashir, T., & Ahmed, A. (2016). Colistin resistance among gram negative organisms; an evolving problem from tertiary care hospital, Pakistan 2014. American Journal of Microbiology. https://doi.org/0.3844/ajmsp.2016.29.31 |
[16]
. However, the usefulness of carbapenems is seriously threatened by the emergence of cabapenemases, notably the newly characterized NDM1.
SHV-type beta-lactamases, including SHV-1 and at least twenty-three variants, generally exhibit broad-spectrum activity against newer broad-spectrum cephalosporins. SHV enzymes belong to the molecular class A of serine β-lactamases and share high functional and structural similarity with TEM β-lactamases
| [17] | Castanheira, M., Doyle, T. B., Deshpande, L. M., Mendes, R. E., & Sader, H. S. (2021). Activity of ceftazidime/avibactam, meropenem/vaborbactam and imipenem/relebactam against carbapenemase-negative carbapenem-resistant Enterobacterales isolates from US hospitals. International Journal of Antimicrobial Agents, 58(5), 106439. https://doi.org/10.1093/ofid/ofad038 |
[17]
.
Bla SHV -1 has spread via plasmids to virtually all species of enterobacteria but is most common in
E. coli. TOHO-2 has high catalytic activity against cephalothin, cephaloridine, cefotaxime, and piperacillin
| [18] | Ling, M., Yoshikazu, I. and Masaji, I (1998) Cloning and Sequencing of Gene En coding Toho-2, a Class A β-Lactamase Preferentially Inhibited by Tazobactam. Antimicrobial Agents and Chemotherapy, 42, 1181-1186. https://doi.org/10.1128/aac.42.5.1181 |
[18]
. TOHO-2 has been reported in Tokyo, Japan, in
E. coli isolated from the urine of a patient treated with β-lactams
| [18] | Ling, M., Yoshikazu, I. and Masaji, I (1998) Cloning and Sequencing of Gene En coding Toho-2, a Class A β-Lactamase Preferentially Inhibited by Tazobactam. Antimicrobial Agents and Chemotherapy, 42, 1181-1186. https://doi.org/10.1128/aac.42.5.1181 |
[18]
.
There were two types of TOHO enzymes (TOHO1 and TOHO2) and their prevalence precise has never been reported in an epidemiological study and the veracity of the sequence was questioned because it was very closely related to CTX M2
. TOHO1 was an ESBL that achieved effective activity not only against penicillins but also against third-generation cephalosporins
| [20] | Sougué, S., Mètuor-Dabiré, A., Ouermi, D., Tiemtoré, Y. R. W. K., Sita, B. S. L. C., Zohoncon, T. M.,... & Simporé, J. (2021). Frequency of Antibiotic Resistance of Escherichia Coli and Klebsiella Pneumoniae by Production of TOHO-type β-lactamases at Saint Camille Hospital, Ouagadougou (Burkina Faso). Advances in Microbiology, 11(12), 713-722. https://doi.org/10.4236/aim.2021.1112051 |
[20]
. Coexistence of
bla TOHO and
bla SHV genes was found in 21.4% of
E. coli strains in our study. Mètuor-Dabiré et
al. reported the coexistence of
bla TOHO and
bla BES genes
in
Escherichia coli (34.4%) at Saint Camille Hospital in Ouagadougou in 2019
| [21] | Mètuor, DA, et al., Detection of multidrug-resistant enterobacteria simultaneously producing extended-spectrum -lactamases of the PER and GES types isolated at Saint Camille Hospital Center, Ouagadougou, Burkina Faso. African Journal of Microbiology Research, 2019. 13(26): p. 414-420. https://doi.org/10.5897/AJMR2019.9147 |
[21]
. Coexistence of
bla SHV and
bla NDM genes
as well as
bla TOHO and
bla NDM was found in 57.14% and 14.29% of the isolates in our study. The coexistence of
bla NDM, bla SHV and
bla TOHO genes
found in 01 (7.14%) of the
E. coli strains in the present study is a factor aggravating antibiotic resistance. This suggests that these genes are carried by the bacterial chromosome and/or plasmids promoting rapid spread both vertically and horizontally to bacteria of other species. However, the development of therapeutic combinations is necessary to maintain humanity's victory over multi-resistance of pathogenic bacteria.
5. Conclusion
Multidrug resistance of E. coli through enzyme production represents a major challenge for the treatment of bacterial infections. This study identified the bla NDM, bla SHV and bla TOHO genes in clinical strains of ESBL-producing Enterobacteriaceae isolated mainly from uropathogenic E. coli. The coexistence of the three genes in the E. coli strain suggests a rapid spread of multidrug resistance. Rigorous surveillance, prudent use of antibiotics, infection control strategies, sequencing and rapid development of new antibiotic combinations or therapeutic solutions at the local level are essential to prevent and combat bacterial multidrug resistance in Burkina Faso.
Abbreviations
CERBA | Pietro Annigoni Research Center |
MH | Muller Hinton |
PCR | Polymerase Chain Reaction |
SHV | Sulfhydryl Variable |
NDM | New Delhi méTallo-bêta-lactamase |
KPC | Klebsiella pneumoniae Co-producing KPC |
ESBLs | Extended Spectrum Beta-lactamases |
CLED | Cystine Lactose Electrolyte Deficient |
BCP | BromoCrésol Pourpre |
SS | Salmonella-Shigella |
DNA | Deoxyribonucleic Acid |
CRO | Ceftriaxone |
CAZ | Ceftazidime |
CTX | Cefotaxime |
IMP | Imipenem |
AMC | Amoxicillin + Clavulanic Acid |
AT | Aztreonam (AT) |
TEM | Temoneira |
EUCAST/ CASFM | European Committee on Antimicrobial Susceptibility Testing / Antibiogram Committee of the French Society of Microbiology |
Author Contributions
Rhaina Olivia Badini: Conceptualization, Formal Analysis, Investigation, Methodology, Writing – original draft
Amana Mètuor Dabiré: Conceptualization, Formal Analysis, Investigation, Methodology, Supervision, Validation, Visualization
Rabiétou Nikiéma: Formal Analysis, Investigation, Methodology
Bambara Eliada Lionel: Formal Analysis, Investigation, Methodology
Abdoul Karim Ouattara: Formal Analysis, Investigation, Methodology, Supervision, Visualization
Théodora Mahoukèdè Zohoncon: Conceptualization, Formal Analysis, Methodology, Project administration, Supervision, Validation
Jacques Simporé: Conceptualization, Investigation, Supervision
Conflicts of Interest
The authors declare no conflicts of interest.
References
| [1] |
Walsh, F. (2003). Family Resilience: A Framework for Clinical Practice. Family Process, 42, 1-18.
https://doi.org/10.1111/j.1545-5300.2003.00001.x
|
| [2] |
Metuor Dabire, A., et al., Resistances to the Oxyimino-Cephalosporins by Ctx-M-15 Producing Klebsiella Isolated From the Urines Samples of Patients in the University Hospital Complex Pediatric Charles De Gaulle (CHUP-CDG) Of Ouagadougou in Burkina Faso Journal of Asian Scientific Research, 2013. 3(9): p. 882-890.
http://aessweb.com/journal-detail.php?id=5003
|
| [3] |
Tiemtoré, RYW, et al., Isolation and Identification of Escherichia coli and Klebsiella pneumoniae Strains Resistant to the Oxyimino-Cephalosporins and the Monobactam by Production of GES Type Extended Spectrum Beta-Lactamase (ESBL) at Saint Camille Hospital Center in Ouagadougou, Burkina Faso. Infect Drug Resist, 2022. 15: p. 3191-3204.
https://doi.org/10.2147/IDR.S360945
|
| [4] |
Ouedraogo AS, Jean Pierre H, Ban˜ uls AL, Oue´ draogo R, Godreuil S. Emergence and diffusion Antibiotic resistance in West Africa: contributing factors and threat assessment. Med Sante Trop 2017; 27: 147-154.
https://doi.org/10.1684/mst.2017.0678
|
| [5] |
Eucast/Ca-Sfm (2021) Antibiogram Committee of the French Society of Microbiology.
|
| [6] |
Morrison, L. and TR Zembower, Antimicrobial Resistance. Gastrointest Endosc Clin N Am, 2020. 30(4): p. 619-635.
|
| [7] |
Diagbouga, S., et al., Detection of High Prevalence of TEM/SHV/CTX-M Genes in ESBL Producing and Multidrug Resistant Klebsiella pneumoniae and Klebsiella oxytoca. J Clin Diagn Res, 2016. 4(1): p. 000129.
https://doi.org/10.4172/2376-0311.1000130
|
| [8] |
Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, infection mechanisms, and treatment options. Nat Rev Microbiol. 2015; 13(5): 269.
https://doi.org/10.1038/NRMICRO3432
|
| [9] |
Huttner, A., et al., Oral amoxicillin and amoxicillin-clavulanic acid: properties, indications and usage. Clin Microbiol Infect, 2020. 26(7): p. 871-879.
https://doi.org/10.1016/j.cmi.2019.11.028
|
| [10] |
Arsalane, L., Kamouni, Y., Yahyaoui, H., Bennouar, N., Berraha, M., & Zouhair, S. (2014). Profile Current antibiotic resistance of uropathogenic Escherichia coli strains and therapeutic consequences. Progress in Urology, 24(16), 1058-1062.
|
| [11] |
Nadmi H, Elotmani F, Talmi M, Zerouali K, Perrier-Gros-Claude JD, Timinouni M. Antibiotic resistance profile of community-acquired uropathogenic Enterobacteriaceae in El Jadida (Morocco). Med Mal Infect 2010; 40: 303-5.
https://doi.org/10.1016/j.medmal.2009.08.020
|
| [12] |
Linefiene, L., Tankoano, A., Fissou Yandai, H., Somda, NS, Oumar, O., & Traoré, Y. (2017). Prevalence and antibiotic susceptibility of diarrheal Escherichia coli strains in children under five years of age in Chad. Rev Microbiol Ind San Et Environn, 11(1), 16-30.
|
| [13] |
Yandaï FH., Zongo C., Moussa AM., Bessimbaye N., Tapsoba F., Savadogo A., Barro N., Ndoutamia, G. & Traoré AS. (2014). Prevalence and antimicrobial usceptibility of faecal carriage of Extended-Spectrum β-lactamase (ESBL) producing Escherichia coli at the “Mother and Child Hospital” in N’Djamena, Chad. Scientific Journal of Microbiology, 3, 25-31.
https://doi.org/10.14196/sjm.v3i2.1152
|
| [14] |
Bonardi, S. and R. Pitino, Carbapenemase-producing bacteria in food-producing animals, wildlife and environment: A challenge for human health. Ital J Food Saf, 2019. 8(2): p. 7956.
https://doi.org/10.4081/ijfs.2019.7956
|
| [15] |
Bi, R., et al., High Prevalence of bla (NDM) Variants Among Carbapenem-Resistant Escherichia coli in Northern Jiangsu Province, China. Front Microbiol, 2018. 9: p. 2704.
https://doi.org/10.3389/fmicb.2018.02704
|
| [16] |
Bashir, T., & Ahmed, A. (2016). Colistin resistance among gram negative organisms; an evolving problem from tertiary care hospital, Pakistan 2014. American Journal of Microbiology.
https://doi.org/0.3844/ajmsp.2016.29.31
|
| [17] |
Castanheira, M., Doyle, T. B., Deshpande, L. M., Mendes, R. E., & Sader, H. S. (2021). Activity of ceftazidime/avibactam, meropenem/vaborbactam and imipenem/relebactam against carbapenemase-negative carbapenem-resistant Enterobacterales isolates from US hospitals. International Journal of Antimicrobial Agents, 58(5), 106439.
https://doi.org/10.1093/ofid/ofad038
|
| [18] |
Ling, M., Yoshikazu, I. and Masaji, I (1998) Cloning and Sequencing of Gene En coding Toho-2, a Class A β-Lactamase Preferentially Inhibited by Tazobactam. Antimicrobial Agents and Chemotherapy, 42, 1181-1186.
https://doi.org/10.1128/aac.42.5.1181
|
| [19] |
Hawkey, PM (2008) Prevalence and Clonality of Extended-Spectrum β-Lactamases in Asia. Clinica.
https://doi.org/10.1111/j.1469-0691.2007.01855.x
|
| [20] |
Sougué, S., Mètuor-Dabiré, A., Ouermi, D., Tiemtoré, Y. R. W. K., Sita, B. S. L. C., Zohoncon, T. M.,... & Simporé, J. (2021). Frequency of Antibiotic Resistance of Escherichia Coli and Klebsiella Pneumoniae by Production of TOHO-type β-lactamases at Saint Camille Hospital, Ouagadougou (Burkina Faso). Advances in Microbiology, 11(12), 713-722.
https://doi.org/10.4236/aim.2021.1112051
|
| [21] |
Mètuor, DA, et al., Detection of multidrug-resistant enterobacteria simultaneously producing extended-spectrum -lactamases of the PER and GES types isolated at Saint Camille Hospital Center, Ouagadougou, Burkina Faso. African Journal of Microbiology Research, 2019. 13(26): p. 414-420.
https://doi.org/10.5897/AJMR2019.9147
|
Cite This Article
-
APA Style
Badini, R. O., Dabiré, A. M., Nikiéma, R., Lionel, B. E., Ouattara, A. K., et al. (2025). Multidrug Resistance of Escherichia Coli by Production of TOHO, NDM and SHV Type Enzymes at the Pietro Annigoni Research Centre (CERBA). Biochemistry and Molecular Biology, 10(3), 52-60. https://doi.org/10.11648/j.bmb.20251003.13
Copy
|
Download
ACS Style
Badini, R. O.; Dabiré, A. M.; Nikiéma, R.; Lionel, B. E.; Ouattara, A. K., et al. Multidrug Resistance of Escherichia Coli by Production of TOHO, NDM and SHV Type Enzymes at the Pietro Annigoni Research Centre (CERBA). Biochem. Mol. Biol. 2025, 10(3), 52-60. doi: 10.11648/j.bmb.20251003.13
Copy
|
Download
AMA Style
Badini RO, Dabiré AM, Nikiéma R, Lionel BE, Ouattara AK, et al. Multidrug Resistance of Escherichia Coli by Production of TOHO, NDM and SHV Type Enzymes at the Pietro Annigoni Research Centre (CERBA). Biochem Mol Biol. 2025;10(3):52-60. doi: 10.11648/j.bmb.20251003.13
Copy
|
Download
-
@article{10.11648/j.bmb.20251003.13,
author = {Rhaina Olivia Badini and Amana Mètuor Dabiré and Rabiétou Nikiéma and Bambara Eliada Lionel and Abdoul Karim Ouattara and Théodora Mahoukèdè Zohoncon and Jacques Simporé},
title = {Multidrug Resistance of Escherichia Coli by Production of TOHO, NDM and SHV Type Enzymes at the Pietro Annigoni Research Centre (CERBA)
},
journal = {Biochemistry and Molecular Biology},
volume = {10},
number = {3},
pages = {52-60},
doi = {10.11648/j.bmb.20251003.13},
url = {https://doi.org/10.11648/j.bmb.20251003.13},
eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.bmb.20251003.13},
abstract = {Antibiotics are drugs used to fight infections caused by bacteria. They are one of the most important discoveries in medicine that has saved and continues to save millions of lives each year, but their effectiveness is threatened because bacteria can adapt and resist treatment. The present study aimed to identify the bla NDM, bla SHV and bla TOHO genes in Escherichia coli strains isolated from patients at the Pietro Annigoni Biomolecular Research Center (CERBA) in Ouagadougou. The isolation and purification of bacterial strains from the stools and urine of internal and external patients of CERBA were carried out on selective media and Muller Hinton (MH) medium. The antibiogram was carried out according to the disc diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the bla NDM, bla SHV and bla TOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were isolated, including 85 (69.67%) strains of E. coli. All E. coli strains were resistant to at least one of the antibiotics studied. Conventional PCR showed that 48.23% (41/85) of E. coli strains carried at least one gene studied. Among the 85 E. coli strains, 35.30% (30/85) of the strains harbored the bla NDM gene, 18.82% (16/85) bla SHV and 8.23% (7/85) of strains carrying the bla TOHO gene. Among the 85 strains, the coexistence of bla SHV genes + blah NDM, blah SHV + blah TOHO, blah TOHO + bla NDM, and bla SHV + bla NDM + bla TOHO were found in 16.47% (14/85) in total. This study has highlighted the multi-resistance of ESBL-producing E. coli strains carrying the bla NDM, bla SHV and bla TOHO genes. The strong coexistence of genes in certain E. coli strains requires efforts to find new therapeutic solutions to combat bacterial resistance.
},
year = {2025}
}
Copy
|
Download
-
TY - JOUR
T1 - Multidrug Resistance of Escherichia Coli by Production of TOHO, NDM and SHV Type Enzymes at the Pietro Annigoni Research Centre (CERBA)
AU - Rhaina Olivia Badini
AU - Amana Mètuor Dabiré
AU - Rabiétou Nikiéma
AU - Bambara Eliada Lionel
AU - Abdoul Karim Ouattara
AU - Théodora Mahoukèdè Zohoncon
AU - Jacques Simporé
Y1 - 2025/09/23
PY - 2025
N1 - https://doi.org/10.11648/j.bmb.20251003.13
DO - 10.11648/j.bmb.20251003.13
T2 - Biochemistry and Molecular Biology
JF - Biochemistry and Molecular Biology
JO - Biochemistry and Molecular Biology
SP - 52
EP - 60
PB - Science Publishing Group
SN - 2575-5048
UR - https://doi.org/10.11648/j.bmb.20251003.13
AB - Antibiotics are drugs used to fight infections caused by bacteria. They are one of the most important discoveries in medicine that has saved and continues to save millions of lives each year, but their effectiveness is threatened because bacteria can adapt and resist treatment. The present study aimed to identify the bla NDM, bla SHV and bla TOHO genes in Escherichia coli strains isolated from patients at the Pietro Annigoni Biomolecular Research Center (CERBA) in Ouagadougou. The isolation and purification of bacterial strains from the stools and urine of internal and external patients of CERBA were carried out on selective media and Muller Hinton (MH) medium. The antibiogram was carried out according to the disc diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the bla NDM, bla SHV and bla TOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were isolated, including 85 (69.67%) strains of E. coli. All E. coli strains were resistant to at least one of the antibiotics studied. Conventional PCR showed that 48.23% (41/85) of E. coli strains carried at least one gene studied. Among the 85 E. coli strains, 35.30% (30/85) of the strains harbored the bla NDM gene, 18.82% (16/85) bla SHV and 8.23% (7/85) of strains carrying the bla TOHO gene. Among the 85 strains, the coexistence of bla SHV genes + blah NDM, blah SHV + blah TOHO, blah TOHO + bla NDM, and bla SHV + bla NDM + bla TOHO were found in 16.47% (14/85) in total. This study has highlighted the multi-resistance of ESBL-producing E. coli strains carrying the bla NDM, bla SHV and bla TOHO genes. The strong coexistence of genes in certain E. coli strains requires efforts to find new therapeutic solutions to combat bacterial resistance.
VL - 10
IS - 3
ER -
Copy
|
Download
,
Amana Mètuor Dabiré
Share This Article
Twitter
Linked In
Facebook
